Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-23bHUMAN, RAT, MOUSEaucacauugccagggauuacc SM-10068
miR-23b ControlSMC-10068
miR-27bHUMAN, RAT, MOUSEuucacaguggcuaaguucugc SM-10070
miR-27b ControlSMC-10070
miR-30bHUMAN, RAT, MOUSEuguaaacauccuacacucagcu SM-10084
miR-30b ControlSMC-10084
miR-122HUMAN, RAT, MOUSEuggagugugacaaugguguuug SM-10046
miR-122 ControlSMC-10046
miR-124HUMAN, RAT, MOUSEuaaggcacgcggugaaugcc SM-10105
miR-124 ControlSMC-10105
miR-125bHUMAN, RAT, MOUSEucccugagacccuaacuuguga SM-10040
miR-125b ControlSMC-10040
miR-128HUMAN, RAT, MOUSEucacagugaaccggucucuuu SM-10044
miR-128 ControlSMC-10044
miR-130aHUMAN, RAT, MOUSEcagugcaauguuaaaagggcau SM-10131
miR-130a ControlSMC-10131
miR-369-3pHUMAN, RAT, MOUSEaauaauacaugguugaucuuu SM-10187
miR-369-3p ControlSMC-10187
miR-451HUMAN, RAT, MOUSEaaaccguuaccauuacugaguu SM-10184
miR-451 ControlSMC-10184
miR-657HUMANggcagguucucacccucucuagg SM-10185
miR-657 ControlSMC-10185
miR-139-5pHUMAN, RAT, MOUSEucuacagugcacgugucuccag SM-10188
miR-139-5p ControlSMC-10188
miR-10bHUMAN, MOUSEuacccuguagaaccgaauuugug SM-10183
miR-10b ControlSMC-10183
miR-224HUMANcaagucacuagugguuccguu SM-10186
miR-224 ControlSMC-10186
miR-342-3pHUMAN, RAT, MOUSEucucacacagaaaucgcacccgu SM-10192
miR-342-3p ControlSMC-10192
miR-193bHUMANaacuggcccucaaagucccgcu SM-10191
miR-193b ControlSMC-10191
miR-29bHUMAN, RAT, MOUSEuagcaccauuugaaaucaguguu SM-10190
miR-29b ControlSMC-10190
miR-154HUMAN, RAT, MOUSEuagguuauccguguugccuucg SM-10197
miR-154 ControlSMC-10197
miR-301aHUMAN, RAT, MOUSEcagugcaauaguauugucaaagc SM-10198
miR-301a ControlSMC-10198
miR-328HUMAN, RAT, RAT, MOUSEcuggcccucucugcccuuccgu SM-10196
miR-328 ControlSMC-10196