Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-204HUMAN, RAT, MOUSEuucccuuugucauccuaugccu SM-10006
miR-204 ControlSMC-10006
miR-2052HUMANuguuuugauaacaguaaugu SM-10027
miR-2052 ControlSMC-10027
miR-205HUMAN, RAT, MOUSEuccuucauuccaccggagucug SM-10063
miR-205 ControlSMC-10063
miR-210HUMAN, RAT, MOUSEcugugcgugugacagcggcuga SM-10012
miR-210 ControlSMC-10012
miR-211HUMANuucccuuugucauccuucgccu SM-10162
miR-211 ControlSMC-10162
miR-212HUMANuaacagucuccagucacggcc SM-10125
miR-212 ControlSMC-10125
miR-214HUMAN, MOUSEacagcaggcacagacaggcagu SM-10064
miR-214 ControlSMC-10064
miR-215HUMANaugaccuaugaauugacagac SM-10143
miR-215 ControlSMC-10143
miR-217HUMANuacugcaucaggaacugauugga SM-10113
miR-217 ControlSMC-10113
miR-218HUMAN, RAT, MOUSEuugugcuugaucuaaccaugu SM-10092
miR-218 ControlSMC-10092
miR-15aHUMAN, MOUSEuagcagcacauaaugguuugug SM-10020
miR-15a ControlSMC-10020
miR-221HUMAN, RAT, MOUSEagcuacauugucugcuggguuuc SM-10045
miR-221 ControlSMC-10045
miR-222HUMAN, RAT, MOUSEagcuacaucuggcuacugggu SM-10038
miR-222 ControlSMC-10038
miR-223HUMAN, MOUSEugucaguuugucaaauacccca SM-10039
miR-223 ControlSMC-10039
miR-200bHUMAN, MOUSEuaauacugccugguaaugauga SM-10079
miR-200b ControlSMC-10079
let-7gHUMAN, MOUSEugagguaguaguuuguacaguu SM-10128
let-7g ControlSMC-10128
let-7iHUMAN, RAT, MOUSEugagguaguaguuugugcuguu SM-10053
let-7i ControlSMC-10053
miR-16HUMAN, RAT, MOUSEuagcagcacguaaauauuggcg SM-10011
miR-16 ControlSMC-10011
miR-1HUMAN, MOUSEuggaauguaaagaaguauguau SM-10015
miR-1 ControlSMC-10015
miR-15bHUMAN, RAT, MOUSEuagcagcacaucaugguuuaca SM-10021
miR-15b ControlSMC-10021