Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-10aHUMAN, RAT, MOUSEuacccuguagauccgaauuugug SM-10176
miR-10a ControlSMC-10176
miR-1204HUMANucguggccuggucuccauuau SM-10158
miR-1204 ControlSMC-10158
let-7eHUMAN, RAT, MOUSEugagguaggagguuguauaguu SM-10159
let-7e ControlSMC-10159
miR-34aHUMAN, RAT, MOUSEuggcagugucuuagcugguugu SM-10007
miR-34a ControlSMC-10007
miR-1297HUMANuucaaguaauucaggug SM-10016
miR-1297 ControlSMC-10016
miR-181aHUMAN, RAT, MOUSEaacauucaacgcugucggugagu SM-10028
miR-181a ControlSMC-10028
miR-548lHUMANaaaaguauuugcggguuuuguc SM-10037
miR-548l ControlSMC-10037
miR-1246HUMANaauggauuuuuggagcagg SM-10163
miR-1246 ControlSMC-10163
miR-181bHUMAN, RAT, MOUSEaacauucauugcugucggugggu SM-10030
miR-181b ControlSMC-10030
miR-1257HUMANagugaaugauggguucugacc SM-10023
miR-1257 ControlSMC-10023
miR-181cHUMAN, RAT, MOUSEaacauucaaccugucggugagu SM-10029
miR-181c ControlSMC-10029
miR-182HUMANuuuggcaaugguagaacucacacu SM-10059
miR-182 ControlSMC-10059
miR-548hHUMANaaaaguaaucgcgguuuuuguc SM-10024
miR-548h ControlSMC-10024
miR-183HUMAN, RAT, MOUSEuauggcacugguagaauucacu SM-10058
miR-183 ControlSMC-10058
miR-548iHUMANaaaaguaauugcggauuuugcc SM-10022
miR-548i ControlSMC-10022
miR-187HUMAN, RAT, MOUSEucgugucuuguguugcagccgg SM-10160
miR-187 ControlSMC-10160
miR-199b-5pHUMANcccaguguuuagacuaucuguuc SM-10141
miR-199b-5p ControlSMC-10141
miR-1321HUMANcagggaggugaaugugau SM-10042
miR-1321 ControlSMC-10042
miR-203HUMAN, RAT, MOUSEgugaaauguuuaggaccacuag SM-10081
miR-203 ControlSMC-10081
let-7fHUMAN, RAT, MOUSEugagguaguagauuguauaguu SM-10127
let-7f ControlSMC-10127