Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-196aHUMAN, RAT, MOUSEuagguaguuucauguuguuggg SM-10076
miR-196a ControlSMC-10076
miR-638HUMANagggaucgcgggcggguggcggccu SM-10018
miR-638 ControlSMC-10018
miR-197HUMAN, MOUSEuucaccaccuucuccacccagc SM-10139
miR-197 ControlSMC-10139
miR-661HUMANugccugggucucuggccugcgcgu SM-10170
miR-661 ControlSMC-10170
miR-198HUMANgguccagaggggagauagguuc SM-10126
miR-198 ControlSMC-10126
miR-449bHUMANaggcaguguauuguuagcuggc SM-10119
miR-449b ControlSMC-10119
miR-199a-5pHUMAN, RAT, MOUSEcccaguguucagacuaccuguuc SM-10140
miR-199a-5p ControlSMC-10140
miR-421HUMAN, MOUSEaucaacagacauuaauugggcgc SM-10111
miR-421 ControlSMC-10111
miR-199a-3pHUMAN, HUMAN, RAT, MOUSE, MOUSEacaguagucugcacauugguua SM-10142
miR-199a-3p ControlSMC-10142
miR-208aHUMAN, RAT, MOUSE, MOUSEauaagacgagcaaaaagcuugu SM-10025
miR-208a ControlSMC-10025
miR-449cHUMANuaggcaguguauugcuagcggcugu SM-10120
miR-449c ControlSMC-10120
let-7dHUMAN, RAT, MOUSEagagguaguagguugcauaguu SM-10052
let-7d ControlSMC-10052
miR-148aHUMAN, MOUSEucagugcacuacagaacuuugu SM-10099
miR-148a ControlSMC-10099
miR-675HUMANuggugcggagagggcccacagug SM-10130
miR-675 ControlSMC-10130
miR-298HUMANagcagaagcagggagguucuccca SM-10144
miR-298 ControlSMC-10144
miR-30cHUMAN, RAT, MOUSEuguaaacauccuacacucucagc SM-10085
miR-30c ControlSMC-10085
miR-30dHUMAN, RAT, MOUSEuguaaacauccccgacuggaag SM-10177
miR-30d ControlSMC-10177
miR-208bHUMAN, MOUSEauaagacgaacaaaagguuugu SM-10026
miR-208b ControlSMC-10026
miR-147HUMANguguguggaaaugcuucugc SM-10123
miR-147 ControlSMC-10123
miR-7HUMAN, RAT, MOUSEuggaagacuagugauuuuguugu SM-10106
miR-7 ControlSMC-10106