Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
U6HUMAN, RAT, MOUSE NR_003027SR-19005
Z38RAT, MOUSE AJ240055SR-19006
Z39RAT, MOUSE AJ240057SR-19007
miR-29aHUMAN, RAT, MOUSEuagcaccaucugaaaucgguua SM-10049
miR-29a ControlSMC-10049
miR-146b-5pHUMAN, MOUSEugagaacugaauuccauaggcu SM-10013
miR-146b-5p ControlSMC-10013
miR-30aHUMAN, RAT, MOUSEuguaaacauccucgacuggaag SM-10082
miR-30a ControlSMC-10082
miR-494HUMAN, MOUSEugaaacauacacgggaaaccuc SM-10097
miR-494 ControlSMC-10097
miR-497HUMANcagcagcacacugugguuugu SM-10152
miR-497 ControlSMC-10152
miR-181dHUMAN, RAT, MOUSEaacauucauuguugucggugggu SM-10165
miR-181d ControlSMC-10165
miR-520eHUMANaaagugcuuccuuuuugaggg SM-10173
miR-520e ControlSMC-10173
miR-31HUMANaggcaagaugcuggcauagcu SM-10036
miR-31 ControlSMC-10036
miR-520a-3pHUMANaaagugcuucccuuuggacugu SM-10168
miR-520a-3p ControlSMC-10168
miR-32HUMAN, RAT, MOUSEuauugcacauuacuaaguugca SM-10155
miR-32 ControlSMC-10155
miR-33aHUMAN, RAT, MOUSEgugcauuguaguugcauugca SM-10181
miR-33a ControlSMC-10181
miR-521HUMANaacgcacuucccuuuagagugu SM-10124
miR-521 ControlSMC-10124
miR-520d-3pHUMANaaagugcuucucuuuggugggu SM-10169
miR-520d-3p ControlSMC-10169
miR-520gHUMANacaaagugcuucccuuuagagugu SM-10178
miR-520g ControlSMC-10178
let-7bHUMAN, RAT, MOUSEugagguaguagguugugugguu SM-10009
let-7b ControlSMC-10009
miR-92aHUMANuauugcacuugucccggccugu SM-10116
miR-92a ControlSMC-10116
miR-93HUMAN, RAT, MOUSEcaaagugcuguucgugcagguag SM-10004
miR-93 ControlSMC-10004