Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-139-3pHUMANggagacgcggcccuguuggagu SM-10381
miR-139-3p ControlSMC-10381
miR-34b*HUMANuaggcagugucauuagcugauug SM-10382
miR-34b* ControlSMC-10382
miR-548d-5pHUMANaaaaguaauugugguuuuugcc SM-10383
miR-548d-5p ControlSMC-10383
miR-495HUMAN, RAT, MOUSEaaacaaacauggugcacuucuu SM-10389
miR-495 ControlSMC-10389
miR-431HUMAN, RAT, MOUSEugucuugcaggccgucaugca SM-10390
miR-431 ControlSMC-10390
miR-541HUMANuggugggcacagaaucuggacu SM-10391
miR-541 ControlSMC-10391
miR-486-3pHUMAN, MOUSEcggggcagcucaguacaggau SM-10392
miR-486-3p ControlSMC-10392
let-7i*HUMAN, RAT, MOUSEcugcgcaagcuacugccuugcu SM-10393
let-7i* ControlSMC-10393
miR-712MOUSEcuccuucacccgggcgguacc SM-10394
miR-712 ControlSMC-10394
miR-483-3pHUMANucacuccucuccucccgucuu SM-10407
miR-483-3p ControlSMC-10407
miR-126-5pHUMAN, RAT, MOUSEcauuauuacuuuugguacgcg SM-10423
miR-126-5p ControlSMC-10423
miR-644HUMANaguguggcuuucuuagagc SM-10424
miR-644 ControlSMC-10424
miR159aARABIDOBSISuuuggauugaagggagcucua SM-10425
miR159a ControlSMC-10425
miR-K12-1HUMANauuacaggaaacuggguguaagc SM-10427
miR-K12-1 ControlSMC-10427
miR-507HUMANuuuugcaccuuuuggagugaa SM-10428
miR-507 ControlSMC-10428
miR-31RAT, MOUSEaggcaagaugcuggcauagcug SM-10430
miR-31 ControlSMC-10430
miR-671-5pHUMAN, MOUSEaggaagcccuggaggggcuggag SM-10432
miR-671-5p ControlSMC-10432
miR-30a*HUMAN, RAT, MOUSEcuuucagucggauguuugcagc SM-10451
miR-30a* ControlSMC-10451
miR-520c-3pHUMANaaagugcuuccuuuuagagggu SM-10452
miR-520c-3p ControlSMC-10452
miR-484HUMAN, RAT, MOUSEucaggcucaguccccucccgau SM-10453
miR-484 ControlSMC-10453