Affymetrix | Panomics Solutions
+1.877.726.6642
Quantitative Biology Delivered.


QuantiGene 2.0 miRNA Probe Sets

QuantiGene miRNA Probe Set and miRNA Control Catalog

If we don't have your miRNA of interest, we can easily design your gene and have it delivered in 3 weeks. There is no additional design or setup fee for By Request probe sets. Please provide gene accession number, species, and symbol or gene sequence and any special design requirements. Probe Sets are 100% guaranteed to perform, or we'll replace them.

To find out if we have your gene of interest in stock, please use the search tool below.

Species Catalog Number Sequence Contains the Phrase
348 records were found
miR-1291HUMANuggcccugacugaagaccagcagu SM-10283
miR-1291 ControlSMC-10283
miR-487bHUMAN, MOUSEaaucguacagggucauccacuu SM-10284
miR-487b ControlSMC-10284
miR-466HUMANauacacauacacgcaacacacau SM-10285
miR-466 ControlSMC-10285
miR-510HUMANuacucaggagaguggcaaucac SM-10289
miR-510 ControlSMC-10289
miR-187*HUMANggcuacaacacaggacccgggc SM-10290
miR-187* ControlSMC-10290
miR-4484HUMANaaaaggcgggagaagcccca SM-10291
miR-4484 ControlSMC-10291
miR-423-5pHUMAN, MOUSEugaggggcagagagcgagacuuu SM-10292
miR-423-5p ControlSMC-10292
miR-4443HUMANuuggaggcguggguuuu SM-10293
miR-4443 ControlSMC-10293
miR-939HUMANuggggagcugaggcucugggggug SM-10294
miR-939 ControlSMC-10294
miR-1469HUMANcucggcgcggggcgcgggcucc SM-10295
miR-1469 ControlSMC-10295
miR-3157HUMANuucagccaggcuagugcagucu SM-10296
miR-3157 ControlSMC-10296
miR-302eHUMANuaagugcuuccaugcuu SM-10297
miR-302e ControlSMC-10297
miR-548jHUMANaaaaguaauugcggucuuuggu SM-10298
miR-548j ControlSMC-10298
miR-432*HUMANcuggauggcuccuccaugucu SM-10299
miR-432* ControlSMC-10299
miR-452HUMANaacuguuugcagaggaaacuga SM-10300
miR-452 ControlSMC-10300
miR-3187HUMANuuggccauggggcugcgcgg SM-10301
miR-3187 ControlSMC-10301
miR-3129HUMANgcaguaguguagagauugguuu SM-10302
miR-3129 ControlSMC-10302
miR-1228*HUMANgugggcgggggcaggugugug SM-10305
miR-1228* ControlSMC-10305
miR-320eHUMANaaagcuggguugagaagg SM-10306
miR-320e ControlSMC-10306
miR-631HUMAN, HUMANagaccuggcccagaccucagc SM-10307
miR-631 ControlSMC-10307